Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105174 |
| Name | oriT_pRHBSTW-00636_2  |
| Organism | Klebsiella pneumoniae strain RHBSTW-00636 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056373 (175422..175471 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRHBSTW-00636_2
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5612 | GenBank | NZ_CP056373 |
| Plasmid name | pRHBSTW-00636_2 | Incompatibility group | IncFIB |
| Plasmid size | 193688 bp | Coordinate of oriT [Strand] | 175422..175471 [+] |
| Host baterium | Klebsiella pneumoniae strain RHBSTW-00636 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | mrkA, mrkB, mrkC, mrkD, mrkF, mrkJ |
| Metal resistance gene | pcoE, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |