Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105172 |
| Name | oriT1_pRHB42-C24_3  |
| Organism | Escherichia fergusonii strain RHB42-C24 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056918 (1149..1236 [-], 88 nt) |
| oriT length | 88 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 88 nt
>oriT1_pRHB42-C24_3
GGGTGTCGGGGCGCAGCCCTGACCAGGTGGTAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCGATTTTT
GGGTGTCGGGGCGCAGCCCTGACCAGGTGGTAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCGATTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5610 | GenBank | NZ_CP056918 |
| Plasmid name | pRHB42-C24_3 | Incompatibility group | ColpVC |
| Plasmid size | 2064 bp | Coordinate of oriT [Strand] | 1149..1236 [-]; 736..818 [+] |
| Host baterium | Escherichia fergusonii strain RHB42-C24 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |