Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105166 |
| Name | oriT_pRHBSTW-00853_5  |
| Organism | Klebsiella grimontii strain RHBSTW-00853 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056154 (936..1035 [+], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 80..85, 90..95 (AAAAAT..ATTTTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_pRHBSTW-00853_5
TATTCCTTTTTTTTCTTTTAATTCATGTAGTTGCGATGAAAATCGCGGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG
TATTCCTTTTTTTTCTTTTAATTCATGTAGTTGCGATGAAAATCGCGGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5604 | GenBank | NZ_CP056154 |
| Plasmid name | pRHBSTW-00853_5 | Incompatibility group | - |
| Plasmid size | 1698 bp | Coordinate of oriT [Strand] | 936..1035 [+] |
| Host baterium | Klebsiella grimontii strain RHBSTW-00853 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |