Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105161
Name   oriT_pRHB02-C14_6 in_silico
Organism   Escherichia fergusonii strain RHB02-C14
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055877 (3874..4156 [-], 283 nt)
oriT length   283 nt
IRs (inverted repeats)      130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..38, 41..48  (GCAAAAAC..GTTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 283 nt

>oriT_pRHB02-C14_6
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGATGCCCCTGGGGGCGCTGCTAGGGGTGTCTATTCAGATAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5599 GenBank   NZ_CP055877
Plasmid name   pRHB02-C14_6 Incompatibility group   Col440I
Plasmid size   5264 bp Coordinate of oriT [Strand]   3874..4156 [-]
Host baterium   Escherichia fergusonii strain RHB02-C14

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -