Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105156
Name   oriT1_pRHBSTW-00002_3 in_silico
Organism   Enterobacter roggenkampii strain RHBSTW-00002
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058198 (36153..36247 [+], 95 nt)
oriT length   95 nt
IRs (inverted repeats)      73..78, 85..90  (AAAAAA..TTTTTT)
 73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
 22..27, 36..41  (GTGATA..TATCAC)
 13..19, 31..37  (TAAATCA..TGATTTA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 95 nt

>oriT1_pRHBSTW-00002_3
TTTTTTTTCTTTTAAATCATTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5594 GenBank   NZ_CP058198
Plasmid name   pRHBSTW-00002_3 Incompatibility group   IncFIB
Plasmid size   108466 bp Coordinate of oriT [Strand]   36153..36247 [+]; 92049..92148 [+]
Host baterium   Enterobacter roggenkampii strain RHBSTW-00002

Cargo genes


Drug resistance gene   -
Virulence gene   rffG
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -