Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105147 |
| Name | oriT_RHBSTW-00001|unnamed  |
| Organism | Klebsiella pneumoniae strain RHBSTW-00001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055598 (525..574 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_RHBSTW-00001|unnamed
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5585 | GenBank | NZ_CP055598 |
| Plasmid name | RHBSTW-00001|unnamed | Incompatibility group | - |
| Plasmid size | 835 bp | Coordinate of oriT [Strand] | 525..574 [+] |
| Host baterium | Klebsiella pneumoniae strain RHBSTW-00001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |