Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105145 |
| Name | oriT_RHBSTW-00001|unnamed  |
| Organism | Klebsiella pneumoniae strain RHBSTW-00001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055595 (3776..3830 [-], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_RHBSTW-00001|unnamed
TCGGGGCGCAGCCCTGAACCAGTCACGTAGCACTAGCGGAGTGTATACTGGCTTA
TCGGGGCGCAGCCCTGAACCAGTCACGTAGCACTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5583 | GenBank | NZ_CP055595 |
| Plasmid name | RHBSTW-00001|unnamed | Incompatibility group | ColRNAI |
| Plasmid size | 4934 bp | Coordinate of oriT [Strand] | 3776..3830 [-] |
| Host baterium | Klebsiella pneumoniae strain RHBSTW-00001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |