Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105140 |
| Name | oriT_RHB03-C23|unnamed  |
| Organism | Escherichia fergusonii strain RHB03-C23 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055814 (180..271 [-], 92 nt) |
| oriT length | 92 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 92 nt
>oriT_RHB03-C23|unnamed
CGTCAGTACCGGGTGTCGGGTAGACCCTGACCAGGTGGTAATTGTAAGACGTTGCGGGCGACGGTATTACAATTGCACATCCTGTCCTGTTT
CGTCAGTACCGGGTGTCGGGTAGACCCTGACCAGGTGGTAATTGTAAGACGTTGCGGGCGACGGTATTACAATTGCACATCCTGTCCTGTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5578 | GenBank | NZ_CP055814 |
| Plasmid name | RHB03-C23|unnamed | Incompatibility group | - |
| Plasmid size | 617 bp | Coordinate of oriT [Strand] | 180..271 [-] |
| Host baterium | Escherichia fergusonii strain RHB03-C23 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |