Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105139 |
| Name | oriT_pRHB03-C23_8  |
| Organism | Escherichia fergusonii strain RHB03-C23 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055813 (1218..1290 [-], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT_pRHB03-C23_8
GTCGGGGTGAAGCCCTGACCAGGTGGTGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGTGAAGCCCTGACCAGGTGGTGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5577 | GenBank | NZ_CP055813 |
| Plasmid name | pRHB03-C23_8 | Incompatibility group | Col |
| Plasmid size | 1902 bp | Coordinate of oriT [Strand] | 1218..1290 [-] |
| Host baterium | Escherichia fergusonii strain RHB03-C23 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |