Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105112 |
| Name | oriT_pRHBSTW-00040_3  |
| Organism | Enterobacter hormaechei strain RHBSTW-00040 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058177 (39347..39447 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | 32..38, 43..49 (TTACGAT..ATCGTAA) 21..26, 38..43 (TTTTCA..TGAAAA) |
| Location of nic site | 62..63 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_pRHBSTW-00040_3
AATTAGAATAATTTGTTTTGTTTTCAAGCATTTACGATGAAAATCGTAATTGCGTATGGTGTATAGCCATTAAGGGACACCATAACACGCCTTTTTTAAGG
AATTAGAATAATTTGTTTTGTTTTCAAGCATTTACGATGAAAATCGTAATTGCGTATGGTGTATAGCCATTAAGGGACACCATAACACGCCTTTTTTAAGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5550 | GenBank | NZ_CP058177 |
| Plasmid name | pRHBSTW-00040_3 | Incompatibility group | IncFIB |
| Plasmid size | 60669 bp | Coordinate of oriT [Strand] | 39347..39447 [+] |
| Host baterium | Enterobacter hormaechei strain RHBSTW-00040 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | ugd, rffG |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |