Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105111
Name   oriT_pRHBSTW-00973_7 in_silico
Organism   Klebsiella pneumoniae strain RHBSTW-00973
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056228 (813..871 [+], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pRHBSTW-00973_7
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5549 GenBank   NZ_CP056228
Plasmid name   pRHBSTW-00973_7 Incompatibility group   -
Plasmid size   1443 bp Coordinate of oriT [Strand]   813..871 [+]
Host baterium   Klebsiella pneumoniae strain RHBSTW-00973

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -