Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105110 |
Name | oriT_pRHBSTW-00973_6 |
Organism | Klebsiella pneumoniae strain RHBSTW-00973 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP056227 (2262..2319 [-], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pRHBSTW-00973_6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5548 | GenBank | NZ_CP056227 |
Plasmid name | pRHBSTW-00973_6 | Incompatibility group | ColRNAI |
Plasmid size | 3223 bp | Coordinate of oriT [Strand] | 2262..2319 [-] |
Host baterium | Klebsiella pneumoniae strain RHBSTW-00973 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |