Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105100 |
| Name | oriT_pRHBSTW-00138_11  |
| Organism | Klebsiella quasipneumoniae strain RHBSTW-00138 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058141 (1319..1501 [+], 183 nt) |
| oriT length | 183 nt |
| IRs (inverted repeats) | 105..110, 115..120 (ACCCCC..GGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 183 nt
>oriT_pRHBSTW-00138_11
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCTACCCCGATTTTGGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAAGCCATAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCTACCCCGATTTTGGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAAGCCATAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5538 | GenBank | NZ_CP058141 |
| Plasmid name | pRHBSTW-00138_11 | Incompatibility group | Col |
| Plasmid size | 2349 bp | Coordinate of oriT [Strand] | 1319..1501 [+] |
| Host baterium | Klebsiella quasipneumoniae strain RHBSTW-00138 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |