Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105098
Name   oriT_pRHBSTW-00138_7 in_silico
Organism   Klebsiella quasipneumoniae strain RHBSTW-00138
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058137 (4455..4514 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-00138_7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5536 GenBank   NZ_CP058137
Plasmid name   pRHBSTW-00138_7 Incompatibility group   ColRNAI
Plasmid size   5665 bp Coordinate of oriT [Strand]   4455..4514 [-]
Host baterium   Klebsiella quasipneumoniae strain RHBSTW-00138

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -