Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105096 |
| Name | oriT_pRHBSTW-00138_2  |
| Organism | Klebsiella quasipneumoniae strain RHBSTW-00138 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058132 (165492..165540 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pRHBSTW-00138_2
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5534 | GenBank | NZ_CP058132 |
| Plasmid name | pRHBSTW-00138_2 | Incompatibility group | IncFIB |
| Plasmid size | 199458 bp | Coordinate of oriT [Strand] | 165492..165540 [+] |
| Host baterium | Klebsiella quasipneumoniae strain RHBSTW-00138 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | mrkJ, mrkF, mrkD, mrkC, mrkB, mrkA |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsC, arsB, arsA, arsD, arsR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |