Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105093 |
Name | oriT_pKP20194b-p2 |
Organism | Klebsiella pneumoniae strain KP20194b |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP054770 (38330..38453 [+], 124 nt) |
oriT length | 124 nt |
IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_pKP20194b-p2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5531 | GenBank | NZ_CP054770 |
Plasmid name | pKP20194b-p2 | Incompatibility group | IncR |
Plasmid size | 133772 bp | Coordinate of oriT [Strand] | 38330..38453 [+] |
Host baterium | Klebsiella pneumoniae strain KP20194b |
Cargo genes
Drug resistance gene | blaCTX-M-65, blaTEM-1B, rmtB, blaSHV-12, blaKPC-2 |
Virulence gene | - |
Metal resistance gene | merE, merD, merA, merP, merT, merR, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIE9 |