Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105084 |
| Name | oriT_pKP20194a-p5 |
| Organism | Klebsiella pneumoniae strain KP20194a |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP054785 (1133..1190 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pKP20194a-p5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5522 | GenBank | NZ_CP054785 |
| Plasmid name | pKP20194a-p5 | Incompatibility group | ColRNAI |
| Plasmid size | 5596 bp | Coordinate of oriT [Strand] | 1133..1190 [-] |
| Host baterium | Klebsiella pneumoniae strain KP20194a |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |