Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105082 |
| Name | oriT_pKP20194a-p2  |
| Organism | Klebsiella pneumoniae strain KP20194a |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP054782 (38329..38452 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_pKP20194a-p2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5520 | GenBank | NZ_CP054782 |
| Plasmid name | pKP20194a-p2 | Incompatibility group | IncR |
| Plasmid size | 133771 bp | Coordinate of oriT [Strand] | 38329..38452 [+] |
| Host baterium | Klebsiella pneumoniae strain KP20194a |
Cargo genes
| Drug resistance gene | blaCTX-M-65, blaTEM-1B, rmtB, blaSHV-12, blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |