Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105076
Name   oriT_pKP20194f-p5 in_silico
Organism   Klebsiella pneumoniae strain KP20194f
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054725 (4365..4422 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)      29..36, 39..46  (CACAGCGT..ACGCTGTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pKP20194f-p5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5514 GenBank   NZ_CP054725
Plasmid name   pKP20194f-p5 Incompatibility group   ColRNAI
Plasmid size   5596 bp Coordinate of oriT [Strand]   4365..4422 [-]
Host baterium   Klebsiella pneumoniae strain KP20194f

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -