Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105072 |
Name | oriT_pKP20194c3-p5 |
Organism | Klebsiella pneumoniae strain KP20194c3 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP054755 (1558..1615 [-], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pKP20194c3-p5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5510 | GenBank | NZ_CP054755 |
Plasmid name | pKP20194c3-p5 | Incompatibility group | ColRNAI |
Plasmid size | 5596 bp | Coordinate of oriT [Strand] | 1558..1615 [-] |
Host baterium | Klebsiella pneumoniae strain KP20194c3 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |