Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105061
Name   oriT_pKP20194d-p1 in_silico
Organism   Klebsiella pneumoniae strain KP20194d
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054733 (134575..134602 [+], 28 nt)
oriT length   28 nt
IRs (inverted repeats)      16..21, 23..28  (ATCAGA..TCTGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 28 nt

>oriT_pKP20194d-p1
AGTTTGGTGCTTATGATCAGAATCTGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5499 GenBank   NZ_CP054733
Plasmid name   pKP20194d-p1 Incompatibility group   IncFIB
Plasmid size   194896 bp Coordinate of oriT [Strand]   134575..134602 [+]
Host baterium   Klebsiella pneumoniae strain KP20194d

Cargo genes


Drug resistance gene   -
Virulence gene   rmpA, iucA, iucB, iucC, iutA
Metal resistance gene   pbrA, terE, terD, terC, terB, terA, terZ, terW
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -