Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105039 |
| Name | oriT_pC2974-5  |
| Organism | Klebsiella pneumoniae strain C2974 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP039799 (31827..31875 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pC2974-5
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5477 | GenBank | NZ_CP039799 |
| Plasmid name | pC2974-5 | Incompatibility group | IncFII |
| Plasmid size | 60383 bp | Coordinate of oriT [Strand] | 31827..31875 [+] |
| Host baterium | Klebsiella pneumoniae strain C2974 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |