Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105035 |
| Name | oriT_p51015  |
| Organism | Klebsiella pneumoniae strain 51015 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP050377 (191..277 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_p51015
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5473 | GenBank | NZ_CP050377 |
| Plasmid name | p51015 | Incompatibility group | - |
| Plasmid size | 1565 bp | Coordinate of oriT [Strand] | 191..277 [+] |
| Host baterium | Klebsiella pneumoniae strain 51015 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |