Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105029
Name   oriT_p47733_COLMG828 in_silico
Organism   Klebsiella pneumoniae strain 47733
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP050363 (408..480 [-], 73 nt)
oriT length   73 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 73 nt

>oriT_p47733_COLMG828
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5467 GenBank   NZ_CP050363
Plasmid name   p47733_COLMG828 Incompatibility group   Col
Plasmid size   1546 bp Coordinate of oriT [Strand]   408..480 [-]
Host baterium   Klebsiella pneumoniae strain 47733

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -