Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104988
Name   oriT_pUSA01-1-SUR10 in_silico
Organism   Staphylococcus aureus strain USA300-SUR10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP014398 (1040..1228 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 133..138, 142..147  (TCTGGC..GCCAGA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_pUSA01-1-SUR10
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5426 GenBank   NZ_CP014398
Plasmid name   pUSA01-1-SUR10 Incompatibility group   -
Plasmid size   3125 bp Coordinate of oriT [Strand]   1040..1228 [+]
Host baterium   Staphylococcus aureus strain USA300-SUR10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -