Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 104955
• Name: oriT_pSA20104250.3
• Organism: Salmonella enterica strain SA20104250
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP030193 (1097..1156 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pSA20104250.3
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 5393
• GenBank: NZ_CP030193
• Plasmid name: pSA20104250.3
• Incompatibility group: Col440I
• Plasmid size: 2264 bp
• Coordinate of oriT [Strand]: 1097..1156 [-]
• Host baterium: Salmonella enterica strain SA20104250

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -