Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104954
Name   oriT_pSA20104250.2 in_silico
Organism   Salmonella enterica strain SA20104250
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP030192 (71..130 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSA20104250.2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5392 GenBank   NZ_CP030192
Plasmid name   pSA20104250.2 Incompatibility group   Col440I
Plasmid size   4096 bp Coordinate of oriT [Strand]   71..130 [+]
Host baterium   Salmonella enterica strain SA20104250

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -