Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 104947
• Name: oriT_pSA20041605.3
• Organism: Salmonella enterica strain SA20041605
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP030228 (1497..1556 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pSA20041605.3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 5385
• GenBank: NZ_CP030228
• Plasmid name: pSA20041605.3
• Incompatibility group: -
• Plasmid size: 3428 bp
• Coordinate of oriT [Strand]: 1497..1556 [+]
• Host baterium: Salmonella enterica strain SA20041605

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -