Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104940
Name   oriT_SA20084699|unnamed2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP022499 (25940..26099 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_SA20084699|unnamed2
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAAACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5378 GenBank   NZ_CP022499
Plasmid name   SA20084699|unnamed2 Incompatibility group   ColRNAI
Plasmid size   38945 bp Coordinate of oriT [Strand]   25940..26099 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -