Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104931
Name   oriT_2020CK-00213|unnamed4 in_silico
Organism   Klebsiella oxytoca strain 2020CK-00213
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP118216 (2944..3002 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_2020CK-00213|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5369 GenBank   NZ_CP118216
Plasmid name   2020CK-00213|unnamed4 Incompatibility group   Col440I
Plasmid size   5197 bp Coordinate of oriT [Strand]   2944..3002 [-]
Host baterium   Klebsiella oxytoca strain 2020CK-00213

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -