Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104918
Name   oriT_NAS_AN_265|unnamed in_silico
Organism   Staphylococcus aureus strain NAS_AN_265
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP062345 (6209..6386 [+], 178 nt)
oriT length   178 nt
IRs (inverted repeats)      152..157, 167..172  (ATTTTA..TAAAAT)
 106..112, 119..125  (TCCCCAT..ATGGGGA)
 89..95, 99..105  (ATCTGGC..GCCAGAT)
 21..28, 33..40  (GTGTCACA..TGTGACAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 178 nt

>oriT_NAS_AN_265|unnamed
TGTGACAAACGCAATATATTGTGTCACAAAACTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATTCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5356 GenBank   NZ_CP062345
Plasmid name   NAS_AN_265|unnamed Incompatibility group   -
Plasmid size   17329 bp Coordinate of oriT [Strand]   6209..6386 [+]
Host baterium   Staphylococcus aureus strain NAS_AN_265

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21