Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104906 |
| Name | oriT_NAS_AN_261|unnamed  |
| Organism | Staphylococcus aureus strain NAS_AN_261 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP062347 (1218..1379 [+], 162 nt) |
| oriT length | 162 nt |
| IRs (inverted repeats) | 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 162 nt
>oriT_NAS_AN_261|unnamed
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGACCTCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAG
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGACCTCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5344 | GenBank | NZ_CP062347 |
| Plasmid name | NAS_AN_261|unnamed | Incompatibility group | - |
| Plasmid size | 45230 bp | Coordinate of oriT [Strand] | 1218..1379 [+] |
| Host baterium | Staphylococcus aureus strain NAS_AN_261 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | etb |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |