Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104860 |
| Name | oriT1_pKPN20-4  |
| Organism | Klebsiella pneumoniae strain KPN20 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP092340 (4386..4437 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT1_pKPN20-4
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGATATTTTTAGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGATATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5298 | GenBank | NZ_CP092340 |
| Plasmid name | pKPN20-4 | Incompatibility group | Col440I |
| Plasmid size | 8069 bp | Coordinate of oriT [Strand] | 4386..4437 [+]; 841..890 [+] |
| Host baterium | Klebsiella pneumoniae strain KPN20 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |