Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104836
Name   oriT_pEcl1-2 in_silico
Organism   Enterobacter hormaechei strain Eho-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP047767 (6074..6233 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pEcl1-2
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5274 GenBank   NZ_CP047767
Plasmid name   pEcl1-2 Incompatibility group   IncFII
Plasmid size   8951 bp Coordinate of oriT [Strand]   6074..6233 [-]
Host baterium   Enterobacter hormaechei strain Eho-1

Cargo genes


Drug resistance gene   aph(3')-VIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -