Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104828 |
| Name | oriT_CriePir197|unnamed2  |
| Organism | Klebsiella pneumoniae strain CriePir197 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP062999 (54339..54438 [-], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 78..83, 90..95 (AAAAAA..TTTTTT) 78..83, 89..94 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 18..24, 36..42 (TAAATCA..TGATTTA) |
| Location of nic site | 60..61 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_CriePir197|unnamed2
ATTTGGTTTTTTTCTTTTAAATCAGTTGGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
ATTTGGTTTTTTTCTTTTAAATCAGTTGGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5266 | GenBank | NZ_CP062999 |
| Plasmid name | CriePir197|unnamed2 | Incompatibility group | IncR |
| Plasmid size | 68226 bp | Coordinate of oriT [Strand] | 54339..54438 [-] |
| Host baterium | Klebsiella pneumoniae strain CriePir197 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsH, arsC, arsB |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |