Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104808 |
| Name | oriT_p2148.C01a  |
| Organism | Staphylococcus aureus strain 2148.C01 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP025488 (1040..1228 [+], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 133..138, 142..147 (TCTGGC..GCCAGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_p2148.C01a
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5246 | GenBank | NZ_CP025488 |
| Plasmid name | p2148.C01a | Incompatibility group | - |
| Plasmid size | 3266 bp | Coordinate of oriT [Strand] | 1040..1228 [+] |
| Host baterium | Staphylococcus aureus strain 2148.C01 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |