Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104768
Name   oriT_pSCC1 in_silico
Organism   Pectobacterium versatile strain SCC1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP021895 (843..902 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSCC1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5207 GenBank   NZ_CP021895
Plasmid name   pSCC1 Incompatibility group   Col440I
Plasmid size   5524 bp Coordinate of oriT [Strand]   843..902 [-]
Host baterium   Pectobacterium versatile strain SCC1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -