Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104726 |
| Name | oriT_pUSA04-1-SUR12  |
| Organism | Staphylococcus aureus strain USA300-SUR12 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP014408 (15153..15341 [-], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 133..138, 142..147 (TCTGGC..GCCAGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pUSA04-1-SUR12
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5165 | GenBank | NZ_CP014408 |
| Plasmid name | pUSA04-1-SUR12 | Incompatibility group | - |
| Plasmid size | 27098 bp | Coordinate of oriT [Strand] | 15153..15341 [-] |
| Host baterium | Staphylococcus aureus strain USA300-SUR12 |
Cargo genes
| Drug resistance gene | aph(3')-III, blaZ, mph(C), msr(A) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |