Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104720 |
| Name | oriT_X-CRHVKP-130|p4  |
| Organism | Klebsiella pneumoniae strain X-CRHVKP-130 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP119178 (58645..58694 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_X-CRHVKP-130|p4
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5159 | GenBank | NZ_CP119178 |
| Plasmid name | X-CRHVKP-130|p4 | Incompatibility group | IncFII |
| Plasmid size | 232058 bp | Coordinate of oriT [Strand] | 58645..58694 [+] |
| Host baterium | Klebsiella pneumoniae strain X-CRHVKP-130 |
Cargo genes
| Drug resistance gene | cmlA1, qacE, blaCTX-M-14, blaKPC-2, blaTEM-1B |
| Virulence gene | rmpA, iucA, iucB, iucC, iutA |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pbrA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |