Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104698 |
| Name | oriT_pI7S6  |
| Organism | Staphylococcus aureus subsp. aureus ST228 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_020538 (18839..19028 [-], 190 nt) |
| oriT length | 190 nt |
| IRs (inverted repeats) | 133..139, 143..149 (GTCTGGC..GCCAGAC) 4..11, 23..30 (CTTTTTTA..TAAAAAAG) 16..21, 24..29 (TTTTTT..AAAAAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 190 nt
>oriT_pI7S6
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5137 | GenBank | NC_020538 |
| Plasmid name | pI7S6 | Incompatibility group | - |
| Plasmid size | 23759 bp | Coordinate of oriT [Strand] | 18839..19028 [-] |
| Host baterium | Staphylococcus aureus subsp. aureus ST228 |
Cargo genes
| Drug resistance gene | blaZ, qacA |
| Virulence gene | - |
| Metal resistance gene | cadC |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |