Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104681 |
| Name | oriT_pG  |
| Organism | Levilactobacillus brevis strain YSJ3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP092271 (998..1035 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pG
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5120 | GenBank | NZ_CP092271 |
| Plasmid name | pG | Incompatibility group | - |
| Plasmid size | 2049 bp | Coordinate of oriT [Strand] | 998..1035 [+] |
| Host baterium | Levilactobacillus brevis strain YSJ3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |