Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104666 |
| Name | oriT_pnunamed2  |
| Organism | Latilactobacillus curvatus strain ZJUNIT8 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029968 (2351..2388 [-], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pnunamed2
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5105 | GenBank | NZ_CP029968 |
| Plasmid name | pnunamed2 | Incompatibility group | - |
| Plasmid size | 9037 bp | Coordinate of oriT [Strand] | 2351..2388 [-] |
| Host baterium | Latilactobacillus curvatus strain ZJUNIT8 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |