Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104661
Name   oriT_AR_0222|unnamed1 in_silico
Organism   Staphylococcus aureus strain AR_0222
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP029670 (23836..24024 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 132..138, 142..148  (GTCTGGC..GCCAGAC)
 71..76, 88..93  (AAAAGC..GCTTTT)
 64..70, 77..83  (GTGTCAC..GTGACAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_AR_0222|unnamed1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5100 GenBank   NZ_CP029670
Plasmid name   AR_0222|unnamed1 Incompatibility group   -
Plasmid size   27276 bp Coordinate of oriT [Strand]   23836..24024 [+]
Host baterium   Staphylococcus aureus strain AR_0222

Cargo genes


Drug resistance gene   blaZ
Virulence gene   sed, sea
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21