Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104654 |
| Name | oriT_pIT4-R  |
| Organism | Staphylococcus aureus strain IT4-R |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP028471 (2861..3038 [+], 178 nt) |
| oriT length | 178 nt |
| IRs (inverted repeats) | 152..157, 167..172 (ATTTTA..TAAAAT) 107..112, 119..124 (CCCCAT..ATGGGG) 89..95, 99..105 (ATCTGGC..GCCAGAT) 44..51, 64..71 (GTCTTTTT..AAAAAGAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 178 nt
>oriT_pIT4-R
TGTGACAAACGCAATATATTGTGTCGCAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTGACAAACGCAATATATTGTGTCGCAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5093 | GenBank | NZ_CP028471 |
| Plasmid name | pIT4-R | Incompatibility group | - |
| Plasmid size | 34104 bp | Coordinate of oriT [Strand] | 2861..3038 [+] |
| Host baterium | Staphylococcus aureus strain IT4-R |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | mco, arsR, arsB, arsC |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |