Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104647
Name   oriT_AR_0225|unnamed1 in_silico
Organism   Staphylococcus aureus strain AR_0225
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP029666 (2738..2976 [-], 239 nt)
oriT length   239 nt
IRs (inverted repeats)      216..221, 231..236  (ATTTTA..TAAAAT)
 170..177, 182..189  (CTATCATT..AATGATAG)
 154..159, 163..168  (TCTGGC..GCCAGA)
 24..31, 43..50  (CTTTTTTA..TAAAAAAG)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 239 nt

>oriT_AR_0225|unnamed1
AAGACATTAGTGATAACTGATGTCTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATAACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5086 GenBank   NZ_CP029666
Plasmid name   AR_0225|unnamed1 Incompatibility group   -
Plasmid size   27063 bp Coordinate of oriT [Strand]   2738..2976 [-]
Host baterium   Staphylococcus aureus strain AR_0225

Cargo genes


Drug resistance gene   blaZ, aph(3')-III, msr(A), mph(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21