Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104635
Name   oriT_pSal017-2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Bovismorbificans strain GSJ/2016-Sal-017
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP069299 (7575..7634 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSal017-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5074 GenBank   NZ_CP069299
Plasmid name   pSal017-2 Incompatibility group   ColRNAI
Plasmid size   10124 bp Coordinate of oriT [Strand]   7575..7634 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Bovismorbificans strain GSJ/2016-Sal-017

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -