Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104609
Name   oriT_pAH5667_1 in_silico
Organism   Staphylococcus aureus strain USA300
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP092053 (1264..1502 [+], 239 nt)
oriT length   239 nt
IRs (inverted repeats)      216..221, 231..236  (TTTTTA..TAAAAA)
 170..177, 182..189  (CTATCATT..AATGATAG)
 154..159, 163..168  (TCTGGC..GCCAGA)
 24..30, 44..50  (CTTTTTT..AAAAAAG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 239 nt

>oriT_pAH5667_1
AAGACATTAGTGTTGACTAATGTCTTTTTTGTTGATTTTTTATAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTAAAAATTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5048 GenBank   NZ_CP092053
Plasmid name   pAH5667_1 Incompatibility group   -
Plasmid size   13162 bp Coordinate of oriT [Strand]   1264..1502 [+]
Host baterium   Staphylococcus aureus strain USA300

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21