Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104605 |
| Name | oriT_pAR8538_4  |
| Organism | Klebsiella quasipneumoniae strain AR8538 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP081830 (14858..14952 [+], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pAR8538_4
TTTTTTTTCTTTTAATTCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAATTCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5044 | GenBank | NZ_CP081830 |
| Plasmid name | pAR8538_4 | Incompatibility group | IncFIA |
| Plasmid size | 55362 bp | Coordinate of oriT [Strand] | 14858..14952 [+] |
| Host baterium | Klebsiella quasipneumoniae strain AR8538 |
Cargo genes
| Drug resistance gene | aph(6)-Id, aph(3'')-Ib, blaDHA-1, sul1, blaNDM-1 |
| Virulence gene | htpB |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |