Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104586
Name   oriT_SWHE1|unnamed3 in_silico
Organism   Klebsiella pneumoniae strain SWHE1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055069 (3694..3751 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_SWHE1|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTGTACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5025 GenBank   NZ_CP055069
Plasmid name   SWHE1|unnamed3 Incompatibility group   Col440I
Plasmid size   6807 bp Coordinate of oriT [Strand]   3694..3751 [-]
Host baterium   Klebsiella pneumoniae strain SWHE1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -