Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104586 |
Name | oriT_SWHE1|unnamed3 |
Organism | Klebsiella pneumoniae strain SWHE1 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP055069 (3694..3751 [-], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_SWHE1|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTGTACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTGTACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5025 | GenBank | NZ_CP055069 |
Plasmid name | SWHE1|unnamed3 | Incompatibility group | Col440I |
Plasmid size | 6807 bp | Coordinate of oriT [Strand] | 3694..3751 [-] |
Host baterium | Klebsiella pneumoniae strain SWHE1 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |