Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 104579
• Name: oriT_STEFF_14|unnamed6
• Organism: Klebsiella pneumoniae strain STEFF_14
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP055192 (1889..1948 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_STEFF_14|unnamed6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 5018
• GenBank: NZ_CP055192
• Plasmid name: STEFF_14|unnamed6
• Incompatibility group: -
• Plasmid size: 2148 bp
• Coordinate of oriT [Strand]: 1889..1948 [+]
• Host baterium: Klebsiella pneumoniae strain STEFF_14

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -